CasHemoTPS (GenBank accession no. EU679406) consisting of 755 amino acid encodes a putative TPS and a TPP domain in tandem. Phylogenic tree analysis of multiple sequence alignments of TPS gene revealed that C. sapidus Hemocytes TPS (CasHemoTPS) is closely related to those of insects, forming a separate group from E. coli, Saccharomyces cerevisae, and Ulva prolifera (Fig. 1) 19. The TPS gene in arthropods appears to be a fused gene of a homolog of Ost A and Ost B in E. coli.

cDNAs of various tissues prepared from an adult male and female C. sapidus were tested for the TPS expression. As shown in Fig. 2, TPS expression was ubiquitous in all the tissues of both sexes of adult crabs, indicating that all these tissues could produce trehalose. It appears that multiple isoforms of TPS genes are present in tissues of the blue crab, as three of these, coding both TPS and TPP, have already been identified (unpublished observation). This wide distribution of TPS gene in crab tissues is surprising in contrast to what has been described in insects. In insects, the fat body is known as the exclusive biosynthetic site of trehalose 42021. After synthesis in the fat body, trehalose is released into hemolymph and serves as a major hemolymph sugar for energy required during flight.

Animals were challenged by the injection of 1 μg LPS to test the response of trehalose. The resting level of trehalose in hemocytes was higher than in hemolymph: 3.5 ± 0.3 mg (n = 6) (Fig. 3A) and 1.1 ± 0.1 mg/ml (n = 6), respectively. In contrast, the level of glucose was higher in hemolymph than in hemocytes: 180 ± 14.6 μg/ml (n = 6) and 70 ± 10 μg/mg protein in hemocyte extracts (n = 6), respectively (Fig. 3B). Overall, the concentration of trehalose was higher than glucose in both hemolymph and hemocytes: 6 and 50 fold, respectively, suggesting that trehalose is a major sugar in crab hemolymph as in insects 421. The intracellular level of trehalose was increased ~2.5 fold in response to the LPS challenge, while a modest 1.5 fold elevation of glucose was found. LPS injection after 24 h did not cause general hypertrehalosemia or hyperglycemia in hemolymph in C. sapidus, although it was reported that a much higher dose of LPS induced hyperglycemia after 2 h in other crustacean species 1315. LPS induced a significant 2.5 fold increase in HemoTPS mRNA, a three fold increment of TPS activity, compared to those of the controls (Figs. 3C and 3D). This could be responsible for the increase in trehalose levels in Fig. 3A. A slight change (130%) in the level of trehalase (Treh) mRNA that breaks down trehalose into two glucose molecules is responsible for the modest rise (1.5 fold) in intracellular glucose. The basal level of TPS mRNA in hemocytes was ~100 fold less than that of Treh.

Our result demonstrates that hemocytes possess TSP and Treh for the synthesis and metabolism of trehalose. More importantly, they modulate cellular trehalose levels for physiological and biochemical adaptation under LPS challenge, through the dynamic regulation of the expression of TPS and TPS enzyme activity. Furthermore, our data indicate that C. sapidus expresses TPS in multiple tissues, in contrast to insects where the fat body is considered the exclusive biosynthesis site of this sugar. Considering trehalose is the major blood sugar, it is also likely to be involved in crustacean hyperglycemia. We anticipate its ubiquitous presence in most if not all crustacean hemolymph with similar functions as those found in insects.

Concentrations of trehalose in hemolymph of C. sapidus showed a bimodal pattern that exhibited two peaks during molt cycle, at early ecdysis and post ecdysis C_1–3 (Fig. 4). The lowest level of trehalose (0.65 ± 0.05 mg/ml hemolymph, n = 8) was measured at stage A during and after the occurrence of the largest water intake occurred 2223. The fluctuation of TPS activity in hemocytes was also noted during the molt cycle from the lowest at intermolt to the highest at postmolt stage B: 0.3 ± 0.08 μmol/h/mg protein in hemocyte extracts (n = 12) and 1.98 ± 0.74 μmol/h/mg protein in hemocyte extracts (n = 7), respectively. TPP enzyme activity of HemoTPS was determined only at intermolt by measuring [Pi] in the same samples that were prepared for TPS activity. The activity of TPP was slightly high: 0.78 ± 0.41 μmol [Pi]/h/mg protein in hemocyte extracts (n = 5), however, this value was not significantly different from that of TPS activity. In general, TPS activity was elevated at premolt and peaked at stage B, which correlates with the highest concentration of trehalose noted at stage C_1–3. The level of trehalose and TPS activity at the postmolt stage imply a possible involvement of this sugar in chitin synthesis, as found in insects 24. Chitin synthesis is required for cuticle hardening and the calcification process in the exoskeleton of animals after ecdysis.

Juvenile blue crabs, C. sapidus (20–30 mm carapace width), were received from the blue crab hatchery in the Aquaculture Research Center, Center of Marine Biotechnology (University of Maryland Biotechnology Institute, Baltimore, MD) and reared as described 25.

Hemocytes were harvested from 1 ml hemolymph withdrawn in a sterilized marine anticoagulant (filtered through 0.22 μm membrane) at 1:1 ratio and immediately spun at 800 g for 10 min 4°C. After discarding the plasma, the pelleted cells were washed once in 100 μl of anticoagulant and re-centrifuged as above. The washed hemocytes were homogenized and total RNA extraction and quantification were carried out by following the procedures as described 26. Degenerate primers of TPS were generated based on the conserved region of insect genes listed in GenBank using a multiple alignment program, CLUSTALW http://www.genome.jp).

The synthesis of 3' RACE cDNA of total RNA of hemocytes was carried out using GeneRacer™ (Invitrogen), while 5' RACE cDNAs was produced using SMART cDNA synthesis kit (BD Biosciences). Touchdown PCR was employed for initial amplification of TPS: dF1 (5'TTYGAYTCYTAYTAYAAYGG3') and dR1 (5'TCDCCRGCDCCRGCRAADGG3'). The cDNA was amplified with Advantage Taq polymerase (BD Biosciences) at the following PCR conditions: after initial denaturation for 2.5 min at 94°C, 3 cycles each step at annealing temperatures: 47°C, 45°C, and 43°C and the final step at 48°C for 25 cycles. The final amplification was achieved at annealing temperature 48°C. The touchdown PCR products served as templates for the nested PCR of TPS with a primer combination of dF2 (5' TTYTGGCCNYTNTTYCAYTCYATGCC 3') and dR2 (5'ATYTGRCARGCSACRAAYTC3') at 55°C annealing temperature. For the TPS gene, the cDNA from hemocytes produced a band with an expected size of 900 bp. The cloning and sequencing procedures were as stated 27. Based on the obtained C. sapidus sequences of TSP, the following gene specific primers (listed in table 1) were made for the completion of 5', 3' RACE.

Tissues were collected from male and female crabs at intermolt stage after they were anesthetized on ice as follows: eyestalk, brain, thoracic ganglion, antennal gland, gill, hindgut, heart, chelae muscle, hypodermis, testis or ovary, hepatopancreas, and Y-organ. Total RNAs were extracted using TRIzol^® (Invitrogen) and quantified with a NanoDrop 1000 (Thermo Scientific). After treatment with DNase I to eliminate genomic DNA contamination, one μg of total RNAs were used for the first cDNA synthesis with MMLV and random hexamers (Promega). Samples of cDNAs (each 12.5 ng) were amplified with a combination of primers: forward, 5'ATGTTGGTGGAACACAATTCAAGGAC3' and reverse, 5' TACAGAAGAGTCTCGGTAGAATGCA for TPS. Arginine kinase, a reference gene, was amplified using the same primers as described 27. The PCR conditions were as follows: initial denaturation at 94°C for 2.5 min, 35 cycles at 94°C for 20 sec, 60°C for 20 sec, 70°C for 30 sec sec, and final step at 70°C for 5 min. PCR products were visualized by staining with ethidium bromide after electrophoresis on a 1.5% agarose gel.

Prior to the injection of LPS or saline, 100 μl of hemolymph was withdrawn from juvenile animals (70–90 mm, carapace width) as described 27 to establish the resting levels of glucose and trehalose in hemocytes. Animals in the test group received 1 μg LPS (E. coli 0111:B4, Sigma) in 100 μl crustacean saline, while control animals received 100 μl saline alone. 24 h after injection, 500 μl of hemolymph were withdrawn in an anticoagulant at a ratio of 1:1 and immediately centrifuged as described above. The hemocytes were re-suspended in ice cold DEPC treated PBS or Tris buffered saline and homogenized. Half of the samples were dedicated for estimating glucose, trehalose, and TPS activity, while the rest were used for RNA extraction as described above. Hemocyte protein was determined using BioRad DC protein assay (BioRad).

The extraction and quantification procedures of total RNA of hemocytes and cDNA synthesis were stated in Chung and Zmora 27. Standards for QRT-PCR were produced as described 25. Sample cDNAs (12.5 – 25 ng) were analyzed for the estimation of the expressions of TPS using primers of QF: 5' ATGTTGGTGGAACACAATTCAAGGAC3' and QR: 5' CTTTGTATAATCTAACCGATCCACTC3' and the data were calculated as copy number/μg of total RNA of hemocytes. The level of hemocyte trehalase (Treh, GenBank accession no. EU679407) was quantified using the following primers, QF: 5' GCAGAGAGTGGATGGGA3' and QR: 5' CCCTGACAGCAGCAAGCCCTCA3'. The expression levels of TPS and Treh were represented as copy number/μg total RNA as described 26.

Glucose levels in hemocytes were determined using glucose oxidase/peroxidase assay (Sigma) as described 28. Trehalose concentration in hemocytes was estimated by subtracting the amount of glucose from the values determined by anthrone assay, as this assay measures both sugars 29. Trehalose (Sigma) was used for the standard of anthrone assay. The results were presented as μg glucose or mg trehalose/mg protein in hemocyte extracts.

TPS activity in hemocytes was estimated using a modified procedure that was previously described 3031. For the first step of the synthesis of trehalose 6-phospate, 100 μg of extracts from hemocytes was incubated in 200 μl final volume of the first reaction mixture containing 50 mM HEPES buffer (pH 7.1), 5 mM UDP-glucose (UDPG), 10 mM glucose-6-phosphate, and 12.5 mM MgCl₂ at 35°C for 30 min. In controls, glucose-6-phosphate was omitted. The reactions were terminated with heat treatment at 100°C for 5 min and were centrifuged at 13,000 rpm for 5 min at room temperature. For the second step, the supernatants (150 μl) were further incubated at 35°C for 10 min in the following reaction mixture (150 mM HEPES buffer, pH 7.6, 2 mM phosphoenolpyruvate, 0.5 mM NADH, 5 U lactic dehydrogenase and 5 U pyruvate kinase). Samples were cooled on ice for 5 min and briefly centrifuged for 13,000 rpm for 1 min. 100 μl of the supernatant was placed into a 96 well plate, and the absorbance was measured at 340 nm (Spectra M5, Molecular Device). Known concentrations of UDP at 1000, 500, 250, 125, and 62.5 nmol were treated as above and served for a standard curve. TPS activity was calculated per μmol UDP/h/mg hemocyte protein.

In order to test the functionality of TPP domain of CasHemoTPS, the hemocytes were extracted in Tris-buffered saline and TPP enzyme activity was measured by following the procedure described in Klutts et al. 32. The activity was calculated as μmol [Pi]/h/mg hemocyte protein.

Hemolymph samples were collected from animals at molt stages as described 33 and assayed as described above. Hemocytes homogenized in 200 μl of ice cold PBS by sonication (Branson); the extracts were centrifuged at 14,000 rpm for 10 min at 4°C; and, the supernatants were collected for the estimation of protein concentration as described above.

Statistical significance was determined at P < 0.05 using GraphPad InStat 3 program (GraphPad Software, Inc).